if a group of____ species lived together in a small area, the cacarrying capacity of that area woukd probaby collapse quickly.

Answers

Answer 1

Answer: R-strategist species. These species are those who reproduce quickly and have lots of offspring. Their rapid population growth would overwhem the carrying capacity.

Related Questions

If the sequence of one single strand of DNA is C-A-A-G-T-A-G-G-C-T, what is the sequence of the complementary strand?
Trace the path of an egg cell by filling in the blanks. After the egg breaks through the ovarian wall, it travels into the _____, which overlies each ovary. From there, it reaches the _____, or womb. If the egg is fertilized by a sperm cell, it is implanted in the _____. uterus; ovary; fallopian tube ovary; fallopian tube; uterus fallopian tube; uterus; endometrium endometrium; uterus; fallopian tube
Another method of _____ is to partially cut a stem and keep it moist until roots form.layeringcuttinggrafting
Which of the following statements accurately describes the process of dating Earth's history?a. Scientists use radiometric dating to determine the relative age of a new fossil.b. Scientists use relative dating to determine the absolute age of a new fossil.c. Scientists use radioactive isotopes to determine the absolute age of a new fossil.d. Scientists use index fossils to determine the specific years of age of a new fossil.
The terms congenital and strangulated are associated with the surgical procedure called

You are most likely to see button mushrooms at a salad bar. These mushrooms are a type of _____ fungi. club; sac; zygote forming; chytrid; imperfect

Answers

Correct answer: A). Club

Club fungi are heterotrophic and it can be saprophytes. The enzyme present in the club fungi decompose the leaves, wood and other organic materials. It can be eaten by other fungi and bacteria.

It is distinguished from the other fungi by the presence of a club-shaped organ called as a basidium. Puffballs, mushroom and shelf fungi are the members of this group.

Hence, the correct answer would be option A.

These mushrooms are a type of club fungi.

Glucose is not able to pass through a semi-permeable cell membrane. If the cells need sugar to make ATP and carry out cellular processes, how does the sugar get into the cell?A) passive transport by diffusion through proteins
B) active transport using ATP and carrier proteins
C) passive transport by osmosis through the proteins
D) active transport using a process called phagocytosis

Answers

The correct option is passive transport by diffusion through proteins.

What is passive transport?

A type of cellular transport known as passive transport involves the movement of molecules and ions along concentration gradients. It indicates that a drug has a propensity to migrate from a region of higher concentration to a region of lower concentration.

Contrary to active transport, another type of cellular transport, which fundamentally requires ATP to move substances against their concentration gradient, the process does not require metabolic energy (e.g. ATP) because the chemicals are moved downhill or along their concentration gradient.

The four main methods of passive transport are osmosis, filtration, simple diffusion, and assisted diffusion.

Therefore, The correct option is passive transport by diffusion through proteins.

To learn more about active transport, refer to the link:

brainly.com/question/12133248

#SPJ6

A) passive transport by diffusion through proteins

Endocrine disruptors are best described as _______.a. highly toxic pesticides
b. hormone mimics
c. plastics precursors
d. industrial byproducts

Answers

Answer:

Endocrine disruptors are the synthetic or natural chemicals that may interfere with the functioning of the endocrine system in the human body. These chemicals mimic the naturally occurring hormones produced in the body like estrogen (a female sex hormone) and androgen (a male sex hormone) also these interfere with the production of the thyroid hormone. They bind to the receptors present in a cell and prevents the endogenous hormone from binding. The normal signaling process fails to respond properly.

Chemicals that functions as endocrine disruptors include dioxine, polychlorinated biphenyls (PCBs), pesticides and DDT.

Answer:

Its B- Hormone Mimics

Create a sentence explaining how amino acids form proteins.

Answers

Within a protein, multiple amino acids are linked together by peptide bonds, thereby forming a long chain. Peptide bonds are formed by a biochemical reaction that extracts a water molecule as it joins the amino group of one amino acid to the carboxyl group of a neighboring amino acid.

Sample answer: Amino acids are monomers that combine to form polymers called proteins.

Which of the following pairs does NOT represent a correct relationship?(A) glucose; polysaccharide
(B) starch; polysaccharide
(C) starch; carbohydrate
(D) glucose; carbohydrate
(E) glucose; monosaccharide

Answers

The pair that is not the correct relationship is glucose and polysaccharide. The correct option is A.

What is a polysaccharide?

The sugar that is included in carbohydrates is referred to as saccharide. As these sugar joined together by certain bonding they lead to the formation of a polymer chain.

This polymer chain having several sugar units is referred to as a polysaccharide.

Glucose is a monomer and is the smallest unit of polysaccharide.

Thus, the correct option is A.

For more details regarding polysaccharide, visit:

brainly.com/question/780562

#SPJ2

A) is incorrect as glucose is a single sugar and not a string of 2 or more sugars such a sucrose is.

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

Answers

Thats a long one, but I got you!

A change in the DNA sequence, such as the mutation you described from 3' GTTACAGCACAGGGTAAACTC 5' to 3' GTTACAGCACAGGGTAAACGC 5', can have a significant impact on the protein produced. This specific type of mutation is called a "point mutation" or "single-nucleotide mutation" because it involves the substitution of a single nucleotide (in this case, a C for a T).

The impact on the protein depends on the role of the altered DNA sequence in encoding the protein. Here are the possible outcomes:

1. **Silent Mutation:** If the mutation does not change the amino acid encoded by the affected codon (a triplet of three nucleotides), it's considered a silent mutation. In this case, the protein's structure and function remain unchanged, as the altered DNA sequence still codes for the same amino acid.

2. **Missense Mutation:** If the mutation changes the codon to one that encodes a different amino acid, it's called a missense mutation. This can lead to an altered protein with potentially different properties or functions, depending on the nature of the new amino acid.

3. **Nonsense Mutation:** If the mutation changes a codon to a stop codon (a codon that signals the end of protein synthesis), it leads to a truncated protein. The protein will be shorter than the original, possibly lacking critical functional domains.

4. **Frameshift Mutation:** In cases where insertions or deletions of nucleotides occur (shifting the reading frame), it can result in a frameshift mutation. This often leads to a nonfunctional or drastically altered protein.

To determine the specific impact of the mutation, you would need to translate the altered DNA sequence into its corresponding amino acid sequence and assess how the change affects the protein's function, structure, and properties. The type of mutation and its consequences can vary, and it's essential to consider the specific genetic code and the context within the protein-coding region.

Other Questions

Sometimes new information results in minor changes to a theory. But sometimes new information results in a theory being discarded as incorrect. An example of an incorrect theory that was disproved by the discovery of new information isPtolemy’s theory of the solar system. the original cell theory. the germ theory. plate tectonic theory.

Which substance is a nucleic acid? amino acid fat polysaccharide RNA

Which one of the following is a characteristic of a metal? A. Changes the color of litmus paper to redB. Conducts heat readilyC. Reacts with bases to produce saltsD. Becomes negative when combined with other elements

Pieces of DNA left at a crime scene can be multiplied by usinga. PCR.b. gel electrophoresis.c. an electrical current.d. whole animal cloning.