Answer:
honestly, it is all up to your preference if you are the tutor or the teacher. It depends on if the student wants to go really in-depth with their work and memorize all the small details, or to know the basics
Explanation:
There are several books that can serve as helpful references for AP biology, including 'Campbell Biology', 'Barron's AP Biology', and 'Cracking the AP Biology Exam'.
When it comes to preparing for AP biology, there are several books that can serve as helpful references. One highly recommended book is 'Campbell Biology' by Jane B. Reece, which is widely used in high school AP biology courses. Another popular book is 'Barron's AP Biology' by Deborah T. Goldberg, which provides comprehensive coverage of the AP biology curriculum. Finally, 'Cracking the AP Biology Exam' by The Princeton Review offers strategies, practice exams, and detailed explanations to help students succeed on the AP biology exam.
#SPJ6
Answer:
I hope this will help you:)
Explanation:
Autotrophic organisms are found in kingdom planted
Heterotrophic organisms are found in kingdom animalia
Kingdom monerans has some organisms like Cyanobacteria that can carry out photosynthesis so they are autotrophswhile the other main category of monerans is not capable of photosynthesis so are heterotrophs so this kingdom includes both o gains s
Kingdom protist are heterotrophs and autotrophs because some can prepare food while others cannot
Kingdom fungi has some organisms that can carry out photosynthesis like algae
while other are heterotrophs
Explanation:
de kingdoms where de aiutotrophs nd heterophic belong is known to be bacteria..there is also kingdoms where in dey r also autotrhoic nd dis is plantae kingdom also dere r kingdom there r only hetetrpohs nd these r animalia nd fungai
Answer:
Water moved out of the cells of the houseplant into the extracellular solution because they (plant cells) have a high water potential (Ψ) than the extracellular environment.
Please find the explanation below
Explanation:
In biology, water potential, denoted by Ψ, refers to the ability of water to move freely in a system. Based on this definition, a hypertonic solution (solution with higher solute concentration) will have a low Ψ while a hypotonic solution (solution with low solute concentration) will have a high Ψ.
According to this question, if a houseplant is fertilized too often, it will increase the concentration of solute in the soil (extracellular environment of the plant cells) i.e. the fertilizer will make the extracellular solution HYPERTONIC. Because the cells of the houseplant are hypotonic to the soil solution i.e. now has a high Ψ in comparison with the soil solution, water will move from the cells of the plant to the soil solution (extracellular) via the cell membrane (semi-permeable membrane) in a process called OSMOSIS.
NOTE: Water moves from a solution with high Ψ to a solution with low Ψ. This is what propels the movement of water from the cell with a high water potential to the exterior of the cell with a low water potential (caused by frequent addition of fertilizer). Overall, the houseplant will look WILTED even if the soil is wet.
Answer:
Water moved out of the cells of the houseplant into the extracellular solution because they (plant cells) have a high water potential (Ψ) than the extracellular environment.
Please find the explanation below
Explanation:
In biology, water potential, denoted by Ψ, refers to the ability of water to move freely in a system. Based on this definition, a hypertonic solution (solution with higher solute concentration) will have a low Ψ while a hypotonic solution (solution with low solute concentration) will have a high Ψ.
According to this question, if a houseplant is fertilized too often, it will increase the concentration of solute in the soil (extracellular environment of the plant cells) i.e. the fertilizer will make the extracellular solution HYPERTONIC. Because the cells of the houseplant are hypotonic to the soil solution i.e. now has a high Ψ in comparison with the soil solution, water will move from the cells of the plant to the soil solution (extracellular) via the cell membrane (semi-permeable membrane) in a process called OSMOSIS.
NOTE: Water moves from a solution with high Ψ to a solution with low Ψ. This is what propels the movement of water from the cell with a high water potential to the exterior of the cell with a low water potential (caused by frequent addition of fertilizer). Overall, the houseplant will look WILTED even if the soil is wet.
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
AIDS still meets the definition of a pandemic.
Your claims should be supported by scientifically complete evidence.
Follow the steps provided to research, plan, and create your presentation. This guide about the research process can help.
Time to complete: 2 to 3 hours
Part A: Ask Questions
Begin by creating a list of questions to guide your research and help you form a convincing argument. Your presentation should answer some of these questions:
What is the definition of a pandemic?
How does a pandemic differ from an endemic or epidemic?
What is the life cycle of the HIV virus once it enters the body? How does the genetic code
of the virus change?
How does HIV affect the body?
How do people become infected with HIV?
How does AIDS develop from an HIV infection?
What are the current infection rates of HIV across the globe?
Where is HIV/AIDS most prevalent?
What treatments are currently available for HIV/AIDS?
Do some regions of the world have better access to treatments than others?
What is the average life expectancy for someone with HIV?
Does life expectancy differ around the globe?
Now write four additional questions about HIV/AIDS that could help strengthen your argument in the presentation.
Based on the information given, a pandemic simply means the spread of an infectiousdisease.
It should be noted that the difference between an epidemic and a pandemic is the degree if its spread.
HIV is simply a virus that attacks the immune system. It can be gotten through unprotected intercourse, sharing sharp objects, etc. It should be noted that in the long run, HIV leads to AIDS.
It should be noted that HIV is most prevalent in Sub Saharan Africa. There are presently no cure for HIV but there are medications to control the complications.
The average life expectancy for someone with HIV is 56 years.
Learn more about pandemic on:
a. decreased portions sizes in restaurarts and movie theaters.
b. increased use of personal vehicles, telephones, and computers.
c. increased number of meals eaten outside the home
Answer:
c. increased number of meals eaten outside the home
Explanation:
Environment is the surrounding of living organism, where he gets to survive by meeting its needs.
Environmental factors are factors in the environment that are associated to growth and development example is temperature.
The environment an individual stays have a great influence on the physical expression and character of the individual.
For a fat person the environment had played out his role which should be controlled to achieve a significant weight loss. Increasing number of meals eaten outside the house is one major factor that would not allow such individual to loose weight. Intake of food should be greatly controlled and watched to achieve weight loss.