Elasticity of demandinelastic
elastic
unitary elastic
total revenue
normal good
inferior good

Answers

Answer 1
Answer:

Answer:

Elasticity of demand refers to the degree of responsiveness of the quantity demanded of a good or service to changes in its price.

Inelastic demand means that the quantity demanded of a good or service is not significantly affected by changes in its price. In other words, demand remains relatively stable even if the price changes.

Elastic demand means that the quantity demanded of a good or service is highly responsive to changes in its price. If the price increases, the quantity demanded decreases significantly, and if the price decreases, the quantity demanded increases significantly.

Unitary elastic demand refers to a situation where the percentage change in the quantity demanded is equal to the percentage change in price. In other words, the demand is neither inelastic nor elastic.

Total revenue is the total amount of money received from the sale of a good or service. It is calculated by multiplying the price of the good or service by the quantity sold.

Normal goods are goods for which demand increases as consumer income increases. These goods are considered to be necessities or luxury goods that people tend to buy more of when they have higher incomes.

Inferior goods are goods for which demand decreases as consumer income increases. These goods are typically seen as lower-quality or less desirable options, and people may switch to better alternatives when they can afford them.


Related Questions

Elaborate the relationship between light intensity and the daily rhythm of flowers opening.
What role does the polyA tail play in mRNA? A) It prevents translation B) It increases mRNA stability C) It decreases mRNA stability D) It affects transcription
16. Which of the following phase changes absorbs heat energy?A. CondensationB. Vaporization C. Deposition D. Freezing
15. Unlike New World monkeys, hominines A. have long fingers and toes. B. have arms that rotate at the shoulder. C. have opposable thumbs. D. have strong clavicles.
Sickle cell anemia is a condition where the red blood cells are deformed. Which is affected by sickle cell anemia?

In the cell cycle, cytokinesis occurs at the end of

Answers

Answer:

The answer is Telophase

Explanation:

Cytokinesis involves the physical separation of the cytoplasm into two daughter cells during cell division. In both mitosis and meiosis occur at the end of telophase, which is the reversal of the processes that took place during the prophase and promethaphase. That is, everything returns to the beginning and the process is repeated.

Cytokinesis occurs after Mitosis. Mitosis is the cell division into two identical nuclei, having the same number and type of chromosomes. Cytokinesis is the division of the cytoplasm that creates two daughter cells that are equal genetically and in size.

How do the waters of El Nino compare to the surrounding ocean?

Answers

The waters get warmer.

The water is warmer in El Nino while the surrounding ocean is cooler.

All of these are Cardiovascular disease EXCEPT Heart Attack
Hypertension
Diabetes
Pulmonary Heart Disease​

Answers

Answer:

Diabetes

Explanation:

Diabetes is a metabolic disease. :)

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

The ATP molecule shown consists of a base,__________, and a chain of three phosphates.

Answers

The ATP molecule shown consists of an adenine base, a ribose sugar, and a chain of three phosphates. ATP (adenosine triphosphate) is used in cells as a coenzyme for energy transfer. It plays a significant role in several biological processes such as cellular respiration (Krebs cycle or citric acid cycle) and fermentation.

You determine that a downed animal is dead. What is the very next thing you should do

Answers

Answer:

prepare game tag and attach it to the animal

Explanation:

The above question is talking about a dead animal due to sport hunting. If you believe the animal has been slaughtered and is dead you should prepare the game tag and attach it to the animal. In doing so, you should be careful to observe if the animal is breathing (even weakly), blinking or moving. Approaching an animal that is scared is unsafe, so you should only attach the game tag to the animal when you are sure it is dead.

P.S. Sport hunting is not a good activity, it causes the suffering of animals only for the enjoyment of the human being. Animals are living beings, have sensations and feelings and must be respected.

Take the animal to the vet?