BIOLOGY HIGH SCHOOL

A plant will wilt if it does not have enough water in the ____ of its cells My choices I have are nucleus, lysosomes, central vacuole, or golgi apparatus

Answers

Answer 1
Answer: Central vacuole. That is the part of the plant that stores most of the water. It is the really large sac you can see in plant cells but  you don't see it in animal cells:) 

Related Questions

[HELP ASAP]Proteins are made up of long chains of which of these building blocks? a. saccharides b. nucleotides c. fatty acids d. amino acids
1.Which career combines DNA technology and medicine?a)pharmaceuticals b)paternity testing c)environmental studies d)biopesticide development 2.A patient is found to be suffering from a bacterial infection. Which genetically engineered medicine is most likely to be used to help this patient? a)insulin b)flu shot c)penicillin d)human growth hormone
What type of consumer is a spider monkey
The _____ theory proposes that the moon was a passing asteroid pulled into orbit by Earth's gravity
If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

How are DNA and chromosomes related to each other

Answers

DNA contains the instructions, genes, to make proteins that tell what genetic traits the person will have. The DNA along with the proteins make up the chromosomes. The chromosomes are then passed on to the offspring, and with the DNA inside the chromosomes and translation of the genes, its traits are decided.

In ΔABC, if the lengths of sides a and c are 8 centimeters and 16 centimeters, respectively, and the measure of ∠C is 35°, what is the measure of ∠A to two decimal places?a. 16.67°

b.17.50°

c.26.57°

d.35.53°

Answers

From sin theorem we know that:

sin(A)/a = sin(C)/c, so sin(A) = asin(C)/c = sin(35deg)/2. So A = arcsin(sin(35deg)/2) = 16.67.

The answer to your question is A. I hope that this is the answer that you were looking for and it has helped you.

Answer:

a 16.67

Explanation:

What type of mutation is a sickle hemoglobin mutation

Answers

Substitution because a base is being taken out and replaced by another base.

Which statement best distinguishes glycolysis and the Krebs cycle from the electron transport chain

Answers

The answer is the amount of ATP produced.

In eukaryotes, electron transport occurs in theA. inner mitochondrial membrane.
B. nucleus.
C. cell membrane.
D. cytoplasm.

Answers

In eukaryotes, the electron transport occurs in the inner mitochondrial membrane.

The correct option is A;  inner mitochondrial membrane.

What is the electron transport chain?

An electron transport chain is a collection of protein complexes and other molecules that associate protons across a membrane with the transfer of electrons from electron donors to electron acceptors via redox processes.

The inner mitochondrial membrane of eukaryotic organisms houses the electron transport chain and the location of oxidative phosphorylation.

Learn more about the electron transport chain at:brainly.com/question/13795741

#SPJ6

Answer:

cwhCBDELCBEQR

Explanation:

CDWCDECHJ

Name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")
Other Questions
The table below shows some characteristics of three different types of muscles.Characteristics of Different Types of MusclesType A Muscles Type B Muscles Type C MusclesStriations Yes Yes NoFound in digestive and urinary system No No YesFound in musculoskeletal system Yes No NoWhich type of muscle is Type B? Cite the evidence from the chart to support your answer.A Type B are skeletal muscles, because only skeletal muscles have striations.B Type B are cardiac muscles, because they are not found in any other part of the body.C Type B are skeletal muscles, because they are not part of the digestive system.D Type B are cardiac muscles, because they do not tire easily.
Adult skin cells can no longer become other types of cells because they have already undergone
Which layer confirms that this sample is soil rather than a mineral mixture?
a scientist claimed that he cloned a guinea pig to produce 2 offspring a male and female. the claim is not valid why