The scales of female pine cones produce a sticky substance. what function might this serve?

Answers

Answer 1

Answer: male pine cones:
they do not have any sticky substance...
also they produce pollens...
female pine cones:
they have the sticky substance to catch the pollen produced by male pine cones...

Related Questions

1. Which of the following would Hopkins say is NOT true of the things mentioned in "Pied Beauty"?a. some are spotted or speckled b. all are worthy of praise c. some are sorrowful d. all are glorious. 2. Both "Pied Beauty" and "Spring and Fall: to a Young Child" suggest a sense of ________. a. disappointment b. nature's beauty c. frustration d. joyfulness
What is a domain, division, family, and taxon? What are the kingdoms currently in use
(blank)production is linked to an increase in the occurrence of skin cancers caused by holes in the ozone layer
All the chromosomes in a diploid cell are paired. True or False
Heyo ooooo oo omloppiesopp

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

Answers

Thats a long one, but I got you!

A change in the DNA sequence, such as the mutation you described from 3' GTTACAGCACAGGGTAAACTC 5' to 3' GTTACAGCACAGGGTAAACGC 5', can have a significant impact on the protein produced. This specific type of mutation is called a "point mutation" or "single-nucleotide mutation" because it involves the substitution of a single nucleotide (in this case, a C for a T).

The impact on the protein depends on the role of the altered DNA sequence in encoding the protein. Here are the possible outcomes:

1. **Silent Mutation:** If the mutation does not change the amino acid encoded by the affected codon (a triplet of three nucleotides), it's considered a silent mutation. In this case, the protein's structure and function remain unchanged, as the altered DNA sequence still codes for the same amino acid.

2. **Missense Mutation:** If the mutation changes the codon to one that encodes a different amino acid, it's called a missense mutation. This can lead to an altered protein with potentially different properties or functions, depending on the nature of the new amino acid.

3. **Nonsense Mutation:** If the mutation changes a codon to a stop codon (a codon that signals the end of protein synthesis), it leads to a truncated protein. The protein will be shorter than the original, possibly lacking critical functional domains.

4. **Frameshift Mutation:** In cases where insertions or deletions of nucleotides occur (shifting the reading frame), it can result in a frameshift mutation. This often leads to a nonfunctional or drastically altered protein.

To determine the specific impact of the mutation, you would need to translate the altered DNA sequence into its corresponding amino acid sequence and assess how the change affects the protein's function, structure, and properties. The type of mutation and its consequences can vary, and it's essential to consider the specific genetic code and the context within the protein-coding region.

Some vertebrates can go through nymph and pupa forms.
True or False

Answers

True, they can

Vertebrates have spinal cord. Spinal Cord is the part of the nervous system responsible for connecting the brain to the body.
The nervous system is divided into two groups. The Central Nervous System and the Peripheral Nervous System.
The Central Nervous System involves the Brain and the Spinal Cord. Its contains the integrative and control centers.

Organisms without a cell structure are known as what?

Answers

Answer:

Acellular Organism

The organisms without a cell structure are known as Non-cellular life or accelular life.

A population of mammals originally lived in a certain area surrounded by land then some of the organisms were taken to an island these two populations remain separated for hundreds of years

Answers

They should diverge slightly, though a mere few hundred years is most likely insufficient for reproductive isolation to occur.

Cattle egrets hitch a ride on domestic cows and eat insects that are stirred up by their activity. What term describes this relationship?

Answers

Ans.

Biological interactions include different types of interactions between organisms that reside together in a community.

Cattle egrets show interaction with domestic cows and feed on the insects present in them. The cattle egrets get food from the cows, while there is no benefit or harm to the cows. This type of biological relationship is known as commensalism, in which one organism, out of interacting organisms, get benefit, while other organism neither harmed or benefit.

Thus, the term that describes this relationship is 'commensalism.'

Which of these is the correct sequence of events leading to evolution

Answers

Most evolutionary occurrences happen when the specie evolves and adapts to have physical features that help them strive in their environment.
This theory contributes to the conservation of biology by helping the scientists to study and understand a population of species and on how they can react and change in their own environments. This will help the scientists to possibly save these species.

Other Questions

The word theory used in a scientific sense most closely means

Which is the primary advantage of instincts, such as the tendency of a mother bear to attack anything between herself and her cubs?

What happens to change young karst topography to mature karst topography?

Which fat is most likely a solid at room temperature?